View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3897_low_5 (Length: 312)
Name: NF3897_low_5
Description: NF3897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3897_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 12 - 296
Target Start/End: Original strand, 10584156 - 10584440
Alignment:
| Q |
12 |
atcatcactatgacttcatatcaaatgaacctgccctaaaaaggaacaagatacttcgacaaaaaccacatatgcctccaccataacaatatacaccatc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10584156 |
atcatcactatgacttcatatcaaatgaacctgccctaaaaaggaacaagatacttcgacaaaaaccacatatgcctccaccataacaatacacaccatc |
10584255 |
T |
 |
| Q |
112 |
aaagcaattaagtagttgcaaatttggtctataattgagcgatactatcaataatatctattgctatgtagtccctacattacagaaggaccctttgaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
10584256 |
aaagcaattaagtagttgcaaatttggtctataattgagcgatactatcaataatatctattgctacgtagtccctacattatagaaggaccctttgaat |
10584355 |
T |
 |
| Q |
212 |
taggtgcaacaatatcaataatctaaacgggaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaat |
296 |
Q |
| |
|
|||||| |||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584356 |
taggtgtaacaatattaataatctaagcggcaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaat |
10584440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University