View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3897_low_7 (Length: 252)
Name: NF3897_low_7
Description: NF3897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3897_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 29 - 240
Target Start/End: Complemental strand, 19118876 - 19118665
Alignment:
| Q |
29 |
aattttccaaacatatcaactataattgtctgcagaagtactattacacctatccaaacagttaatgtagaccctcatactatgcatgatagtagaaatc |
128 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19118876 |
aattgtccaaacatatcaactataattgtctgcagaagtactattacacctatccaaacagttaatgtagaccctcatattatgcatgatagtagaaatc |
19118777 |
T |
 |
| Q |
129 |
tacactgagggtatctttattgcaatcagctaataccaacaactaatttatgcataagggtccctatatttaatatactcacattcactctattgcttcc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
19118776 |
tacactgagggtatctttattgcaatcagctaataccaacaactaatttatgcataagggtccctataattaatatactcacattcactctattgctgcc |
19118677 |
T |
 |
| Q |
229 |
tctatagtataa |
240 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
19118676 |
tctatattataa |
19118665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University