View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3898_high_12 (Length: 281)
Name: NF3898_high_12
Description: NF3898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3898_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 6011748 - 6011491
Alignment:
| Q |
17 |
aaaaaccgaattatagtttgattagcatgatgttttttcaacagtgaccaatttcgtctcaaagatccaagtctgattcatgtcgtttttacgaggaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
6011748 |
aaaaaccgaattatagtttgattagcatgatgttttttcaacagcgaccaatttcgtctcaaagacccaagtctgattcatgtcgtttttacgaggagtt |
6011649 |
T |
|
| Q |
117 |
ggatttgactgtcatacactgcggcttggtgagcttggatgtttcttcacgaaactagtgccaccgatataatcaacggtcaaaaagtgatctatttgaa |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6011648 |
ggatttgactgtcatacactgcgacttggtgaccttggatacttcttcacgaaactagtgccaccgatataatcaacggtcaaaaagtgatctctttgaa |
6011549 |
T |
|
| Q |
217 |
atcaaatcaaaaggacgaagtactgatattgtctatattacacaatgaacctatgttt |
274 |
Q |
| |
|
||||||| ||||||||||||||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
6011548 |
atcaaattaaaaggacgaagtactgctgttgtctatattacacaatgaacatatgttt |
6011491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 74 - 129
Target Start/End: Original strand, 7979257 - 7979312
Alignment:
| Q |
74 |
ctcaaagatccaagtctgattcatgtcgtttttacgaggaattggatttgactgtc |
129 |
Q |
| |
|
||||||||| ||| ||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
7979257 |
ctcaaagattcaattctgatttatgtcgtttttacgagcaattggatttgactgtc |
7979312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University