View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3898_high_8 (Length: 339)
Name: NF3898_high_8
Description: NF3898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3898_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 319
Target Start/End: Complemental strand, 1056946 - 1056657
Alignment:
| Q |
15 |
catcagagtcttggttgaggagaaacaacaatgcaacggtattttaataacgagatatcatatttcaggattactatctatctataaactcttagaaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1056946 |
catcagagtcttggttgaggagaaacaacaatgcaacggtcttttaataacgagatatc---------------tatctatctataaactcttagaaatg |
1056862 |
T |
 |
| Q |
115 |
aatttaagcatgtagtgaaatttcaataaatcaacatgtaatgtatcctatggttatcgtatatccagagattattgttacaataagtgtattgagcata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1056861 |
aatttaagcatgtagtgaaatttcaataaatcaacatgtaatgtatcctatggttatcgtatatccagagattattgttacaataagtgtattgagaata |
1056762 |
T |
 |
| Q |
215 |
aattgtgacgaatgtaagaagaaaaacgtaccggaatatcggaagaattgaaaaagttaggggaagaattggaagaatggttacgatcaacaacggagga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056761 |
aattgtgacgaatgtaagaagaaaaacgtaccggaatatcggaagaattgaaaaagttaggggaagaattggaagaatggttacgatcaacaacggagga |
1056662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University