View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3898_low_16 (Length: 259)
Name: NF3898_low_16
Description: NF3898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3898_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 36640903 - 36640666
Alignment:
| Q |
11 |
cagagaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36640903 |
cagagaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttg |
36640806 |
T |
 |
| Q |
111 |
ctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640805 |
ctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtg |
36640706 |
T |
 |
| Q |
211 |
gggcgtgtttagctgataggtgggattgtgttgatgatgt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640705 |
gggcgtgtttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 243
Target Start/End: Complemental strand, 36633537 - 36633305
Alignment:
| Q |
11 |
cagagaaatgaactcatttgcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
36633537 |
cagagaaatgaactcatttgcagatgctttagcaaaaagtggcgtgaatatggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttg |
36633438 |
T |
 |
| Q |
111 |
ctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36633437 |
ctagtttgcaattcaaaatttattttacagaaatagagaaatctatttgtatatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtg |
36633338 |
T |
 |
| Q |
211 |
gggcgtgtttagctgataggtgggattgtgttg |
243 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
36633337 |
gggtgtgtttagctgataggtgggattgtgttg |
36633305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University