View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3898_low_18 (Length: 248)
Name: NF3898_low_18
Description: NF3898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3898_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 34362461 - 34362397
Alignment:
| Q |
126 |
gcatcttcatggtttctgttaaaagataaactttgtctaaatatcttatttgtaggccaagaaat |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362461 |
gcatcttcatggtttctcttaaaagataaactttgtctaaatatcttatttgtaggccaagaaat |
34362397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 230
Target Start/End: Complemental strand, 34362373 - 34362333
Alignment:
| Q |
189 |
atcatattcaaaaagtcgcaaaaagtcttgggtatgacgacc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34362373 |
atcatattcaaaaagtcgcaaaaagtctt-ggtatgacgacc |
34362333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 45
Target Start/End: Complemental strand, 34362571 - 34362542
Alignment:
| Q |
16 |
atgtgggtgaggatttttttggtggttaaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34362571 |
atgtgggtgaggatttttttggtggttaaa |
34362542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University