View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_high_5 (Length: 325)
Name: NF3899_high_5
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 15 - 307
Target Start/End: Complemental strand, 34962656 - 34962364
Alignment:
| Q |
15 |
actacagagtttttaagtcagaacggattaaacggacctcacccggcggaatcatcggcagcagcgaggcaaggacggaggagtacaccacttttcttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962656 |
actacagagtttttaagtcagaacggattaaacggacctcacccggcggaatcatcggcagcggcgaggcaaggacggaggagtacaccacttttcttaa |
34962557 |
T |
 |
| Q |
115 |
gagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttcccgccatcagagactgatccgatcgatttcacggagaggatggaagcgcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962556 |
gagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttcccgccatcagagactgatccgatcgatttcacggagaggatggaagcgcc |
34962457 |
T |
 |
| Q |
215 |
attggtgagatgttcacgatgaagtttgttgagacgagggagggaggagagtgtggtggcgcgtgacaacactcgtgactccattgggatcaa |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962456 |
attggtgagatgttcacgatgaagtttgttgagacgagggagggaggagagtgtggtggcgcgtgacaacactcgtgactccattgggatcaa |
34962364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University