View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_11 (Length: 274)
Name: NF3899_low_11
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 3773206 - 3773053
Alignment:
| Q |
1 |
tcttcattcaatattgtaagtatggcgaaattctaacccgtgcttgacacgagttttcatacaagtatatg--tataaatgcaaattaagaaagagaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3773206 |
tcttcattcaatattgtaagtatggcgaaattctaacccgtgcttgacacgagttttcatacaagtatatgtatataaatgcaaattaagaaagagaaaa |
3773107 |
T |
 |
| Q |
99 |
acttgt-nnnnnnnngagagagaaaactttgcgtgatgtatactctttattcta |
151 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3773106 |
acttgtaaaaaaaaagagagagaaaactttgcgtgatgtgtactctttattcta |
3773053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 269
Target Start/End: Complemental strand, 3772974 - 3772921
Alignment:
| Q |
216 |
ggtactagaaatagaaaaatattttttccttgtacattctactcctttgcttct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
3772974 |
ggtactagaaatagaaaaatattttttccttgtacattctactccattgtttct |
3772921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 20070711 - 20070772
Alignment:
| Q |
1 |
tcttcattcaatattgtaagtatggcgaaattctaacccgtgcttgacacgagttttcatac |
62 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20070711 |
tcttcatccattattgtaagtatgaaaaaattctaactcgtgcttgacacgagtttccatac |
20070772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 29651603 - 29651553
Alignment:
| Q |
1 |
tcttcattcaatattgtaagtatggcgaaattctaacccgtgcttgacacg |
51 |
Q |
| |
|
||||||| ||||||| ||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
29651603 |
tcttcatccaatattttaattatgacgaaattctaacccgtacttgacacg |
29651553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University