View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3899_low_18 (Length: 218)

Name: NF3899_low_18
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3899_low_18
NF3899_low_18
[»] chr7 (3 HSPs)
chr7 (16-167)||(10383726-10383877)
chr7 (16-125)||(10380582-10380691)
chr7 (134-189)||(10380502-10380557)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 10383877 - 10383726
Alignment:
16 atgaagattgttctacaagattggatccggtttcgaaatggcgcgcagaagaacaatgcaacagaaatagtggctttgaggtggccacaaaagtgcatag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |    
10383877 atgaagattgttctacaagattggatccggtttcgaaatggcgtgcagaagaacaatgcaacagaaaaagtggctttgaggtggccacagaagtgcattg 10383778  T
116 gatgaagatacggttctcaagttttcccagataattcatattaagaaaaaca 167  Q
    ||||||||||| | |||||||||||| |||| |||||||||||||| |||||    
10383777 gatgaagatacagctctcaagttttcacagagaattcatattaagataaaca 10383726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 125
Target Start/End: Complemental strand, 10380691 - 10380582
Alignment:
16 atgaagattgttctacaagattggatccggtttcgaaatggcgcgcagaagaacaatgcaacagaaatagtggctttgaggtggccacaaaagtgcatag 115  Q
    |||| |||||||||| | ||||||||||| ||| ||||  | | | | || |||||||||||||||| | || |||||||||||||||| ||||||||||    
10380691 atgacgattgttctagatgattggatccgctttagaaaacgtgtgaaaaacaacaatgcaacagaaaaaatgactttgaggtggccacagaagtgcatag 10380592  T
116 gatgaagata 125  Q
    ||||||||||    
10380591 gatgaagata 10380582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 189
Target Start/End: Complemental strand, 10380557 - 10380502
Alignment:
134 aagttttcccagataattcatattaagaaaaacagattacagatttctctttatct 189  Q
    |||||||| |||| ||||||| ||||||||||||| || ||||||||| |||||||    
10380557 aagttttcacagacaattcatgttaagaaaaacagcttgcagatttctttttatct 10380502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University