View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_19 (Length: 205)
Name: NF3899_low_19
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 190
Target Start/End: Original strand, 38846547 - 38846726
Alignment:
| Q |
11 |
gagcacagacaatggcacataaaatggctgctacaagaaccatccaatcaaaaccagctacttgttcatgatcatggtgcttgttgtcacatggtatggg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38846547 |
gagcacaaacaatggcacataaaatggctgctacaagaaccatccaatcaaaaccagctacttgttcatgatcatggtgcttgttgtcacatggtatggg |
38846646 |
T |
|
| Q |
111 |
agattgagagtgagaatgagaattattttcagccatatggagatggaaaagtaatgaataataatgggaatttggaacat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38846647 |
agattgagagtgagaatgagaattattttcagccatatggagatggaaaagtaatgaataataatgggaatttggaacat |
38846726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University