View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_5 (Length: 383)
Name: NF3899_low_5
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 147 - 341
Target Start/End: Original strand, 46717581 - 46717775
Alignment:
| Q |
147 |
cttctaaatcctaattcgaaatgtaggttcatcatgagaggtttttctgcacggagtatgagaaatcaaaggttgctaccgataaaattgcattgcaagc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46717581 |
cttctaaatcctaattcgaaatgtaggttcatcatgagaggtttttctgcacggagtatgagaaatcaaaggttgctaccgataaaattgcattgcaagc |
46717680 |
T |
|
| Q |
247 |
tgcttctgagggggtgccaatagtgttgctttatcctggggtaatttatggacctggaaaagttactgcaggaaacgttgttgcaaagatggtac |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46717681 |
tgcttctgagggggtgccaatagtgttgctttatcctggggtaatttatggacctggaaaagttactgcaggaaacgttgttgcaaagatggtac |
46717775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 14 - 118
Target Start/End: Original strand, 46717448 - 46717552
Alignment:
| Q |
14 |
agacagtggagaaacttgtatacacgtcgtcgtttttcgctcttggaccaaccgatggacctattgctgatgagaatcaagtacaatacatcaaatcaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46717448 |
agacagtggagaaacttgtatacacgtcgtcgtttttcgctcttggaccaaccgatggagctattgctgatgagaatcaagtacaatacatcaaatcaat |
46717547 |
T |
|
| Q |
114 |
acttc |
118 |
Q |
| |
|
||||| |
|
|
| T |
46717548 |
acttc |
46717552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University