View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_6 (Length: 356)
Name: NF3899_low_6
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 21 - 347
Target Start/End: Original strand, 34029385 - 34029712
Alignment:
| Q |
21 |
ttagatccataccatatggacaagtcaagaaaactcatttcaggcatcttgtttgttatattttgctttgttgtttatcaagtcaaaatctttaaaggaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34029385 |
ttagatccataccatatggacaagtcaagaaaactcatttcaggcatcttgtttgttatattttgctttgttgtttatcaagtcaaaatctttaaaggaa |
34029484 |
T |
|
| Q |
121 |
tatgattttcttgattaaatcttgagacttttagaagaagggaactatgtgagttgttccttttcatttccgttttctctgagagtttagaagtattccc |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34029485 |
tatgattttcttgattaaatctagagacttttagaagaagggaactatgtgaggtgttccttttcatttccgttttctctgagagtttagaagtattccc |
34029584 |
T |
|
| Q |
221 |
ctgtaattccttaggtggaggag-ctagatagaattgacgggagaaactgaatcatgagactttcttgaattatttcaggcatcatcctttcttgaatta |
319 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34029585 |
ctgtaattccttaggtggaggagcctagatagaattgacgggagaaactgaatcatgagactttcttgaattatttcaggcatcatcctttcttgaatta |
34029684 |
T |
|
| Q |
320 |
ttgatggaattaaaaaatgtagtattat |
347 |
Q |
| |
|
|||||||||| |||| |||||||||||| |
|
|
| T |
34029685 |
ttgatggaatgaaaacatgtagtattat |
34029712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University