View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_7 (Length: 354)
Name: NF3899_low_7
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 16 - 344
Target Start/End: Original strand, 20131213 - 20131541
Alignment:
| Q |
16 |
aataggattactggaagcattcctaagacaataggaaatctcaggaatttgaactttttagatctctctgggaaccgtctttcagggccggttcccgatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20131213 |
aataggattactggaagcattcctaagacaataggaaatctcaggaatttgaactttttagatctctctgggaaccgtctttcagcgccggttcccgatg |
20131312 |
T |
 |
| Q |
116 |
aaataagaagctgcatacaacttcaaatgatagacttcagctctaacaacttagaaggctcgcttcctaattccttgtcatcgttatcttcacttcaggt |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20131313 |
aaataagaagctgcgtacaacttcaaatgatagacttcagctctaacaacttagaaggctcgcttcctaattccttgtcatcattatcttcacttcaggt |
20131412 |
T |
 |
| Q |
216 |
attggatgcatcttttaacaagttttcaggtccgttgccggcaggtttaggtcgtcttgtttcattaagtaagttaatctttggaaataacttgttttct |
315 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131413 |
attggatgcatcgtttaacaagttttcaggtccgttgccggcaagtttaggtcgtcttgtttcattaagtaagttaatctttggaaataacttgttttct |
20131512 |
T |
 |
| Q |
316 |
ggaccaattcctgaatcactaagcctatg |
344 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
20131513 |
ggaccaattcctgcatcactaagcctatg |
20131541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University