View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3899_low_9 (Length: 318)
Name: NF3899_low_9
Description: NF3899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3899_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 21 - 314
Target Start/End: Original strand, 41036884 - 41037177
Alignment:
| Q |
21 |
atgtcttgtctcaaaacagccattgttggccctaccttatctgcaagacaatcaatcaataaaaaacatacttaaaatttgtttggtgttacataactat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41036884 |
atgtcttgtctcaaaacagccattgttggccctaccttatctgcaagataatcaatcaataaaaaacatacttaaaatttgtttggtgttacataactat |
41036983 |
T |
 |
| Q |
121 |
catgattaaaaataaatgaaaaatgttggtactaaccaagaacttgtagaaccatgtaacataaagataggaaaggctttgttgggatgcgtgcaccaga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41036984 |
catgattaaaaataaatgaaaaatgttggtactaaccaagaacttgtagaaccatgtaacataaagataggaaaggctttgttgggatgcgtgcaccagc |
41037083 |
T |
 |
| Q |
221 |
ctcatgatcttcttcaggtttgactataacaagcactgaaagctcttcaatggcagagtttatctctgatctcttctctatatctctgctcctc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41037084 |
ctcatgatcttcttcaggtttgactataacaagcactgaaagctcttcaatggcagagtttatctctgatctcttctctatatctctactcctc |
41037177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 9871529 - 9871490
Alignment:
| Q |
24 |
tcttgtctcaaaacagccattgttggccctaccttatctg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9871529 |
tcttgtctcaaaacagccattgttggccctattttatctg |
9871490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 9871384 - 9871340
Alignment:
| Q |
155 |
accaagaacttgtagaaccatgtaacataaagataggaaaggctt |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
9871384 |
accaagaacttgtagaaccaaataacatatagagaggaaaggctt |
9871340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University