View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3900_high_16 (Length: 234)
Name: NF3900_high_16
Description: NF3900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3900_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 50649646 - 50649445
Alignment:
| Q |
18 |
attctgatggtgcaacaatcacgggcaagtccactgatgaatctcagataattgtaaaagggctatcatcacaagtccctgtcatgaattatgttgaggt |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50649646 |
attctgatggtgcgacaatcacgggcaagtccactgatgaatctcagataattgtaaaagggctatcatcacaagtccctgtcatgaattatgttgaggt |
50649547 |
T |
 |
| Q |
118 |
tattggcattgctgaaagtaacaactctattcgtgctgaaatattgactgactttggtgccacatttggtatgaagcattattgtgtttatctatataat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50649546 |
tattggcattgctgaaagtaacaactctattcgtgctgaaatattgactgactttggtgccacatttggtatgaagcattattgtgtttatctatataat |
50649447 |
T |
 |
| Q |
218 |
tt |
219 |
Q |
| |
|
|| |
|
|
| T |
50649446 |
tt |
50649445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 50660058 - 50659861
Alignment:
| Q |
18 |
attctgatggtgcaacaatcacgggcaagtccactgatgaatctcagataattgtaaaagggctatcatcacaagtccctgtcatgaattatgttgaggt |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50660058 |
attctgatggtgcgacaatcacgggcaagtccactgatgaatctcagataattgtaaaagggctatcatcacaagtccctgtcatgaattatgttgaggt |
50659959 |
T |
 |
| Q |
118 |
tattggcattgctgaaagtaacaactctattcgtgctgaaatattgactgactttggtgccacatttggtatgaagcattattgtgtttatctatata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
50659958 |
tattggcattgctgaaagtaacaactctatccatgctgaaatattgactgactttggtgccacatttggtaagaagcactattgtttttatctatata |
50659861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University