View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3901_low_3 (Length: 306)
Name: NF3901_low_3
Description: NF3901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3901_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 12 - 287
Target Start/End: Complemental strand, 30297056 - 30296783
Alignment:
| Q |
12 |
catcatcatcggtaagcctgttagaagtccaagttgtatgaatgattgagaagcaagagctgtttctaaggactgtacattcttgattcttgcttcaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30297056 |
catcatcatcggtaagcctgttagaagtccaagttgtatgaatgattgagaagcaagagctgtttctaaggactgtacattcttgattcttgcttcaatg |
30296957 |
T |
 |
| Q |
112 |
ataagtgctctctctaagccgctaagaacaaggtataactgtccgtagagaaatacatatattcctattactgatatctgtgaagaaatgcaatagattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296956 |
ataagtgctctctctaagccgctaagaacaaggtataactgtccgtagagaaatacatatattcctattactgatatctgtgaagaaatgcaatagattt |
30296857 |
T |
 |
| Q |
212 |
atatcagtcaaaattgcattatgtaaagaatctatacatgtcatacttctcttcatataggcaacaggatagtgaa |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296856 |
atatcagtcaaaattgcattatg--aagaatctatacatgtcatacttctcttcatataggcaacaggatagtgaa |
30296783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University