View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3901_low_4 (Length: 289)
Name: NF3901_low_4
Description: NF3901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3901_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 274
Target Start/End: Complemental strand, 45383535 - 45383281
Alignment:
| Q |
19 |
acataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaaattttgctcaattctcttgaaactctacctataaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383535 |
acataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaatttttgctcaattctcttgaaactctacctataaaa |
45383436 |
T |
|
| Q |
119 |
ggacacctcagctaggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcgtttagtgtttgcatatacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45383435 |
ggacacctcagctaggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcg-ttagtgtttgcatatacaa |
45383337 |
T |
|
| Q |
219 |
cacccctgccaaagagctcagccatcgtcctcagttgcgtttcatcaaccgaccat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383336 |
cacccctgccaaagagctcagccatcgtcctcagttgcgtttcatcaaccgaccat |
45383281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University