View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3902_high_15 (Length: 212)

Name: NF3902_high_15
Description: NF3902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3902_high_15
NF3902_high_15
[»] chr5 (2 HSPs)
chr5 (5-201)||(40603578-40603774)
chr5 (53-201)||(41190929-41191085)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 40603578 - 40603774
Alignment:
5 gattcttggggaaattgcacataccaccgttagatattctgaattgaagtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcgg 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40603578 gattcttggggaaattgcacataccaccgttagatattctgaattgaagtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcgg 40603677  T
105 attctttgataaccaccatggccaacttatgaaagatggcggtgccatggcgtatttttggctttccaccgttgataactctggaaattacacccct 201  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||    
40603678 attctttgataaccaccatggccaacttatgaaagatggcggcgccatagcgtatttttggctttccacagttgataactctggaaattacacccct 40603774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 53 - 201
Target Start/End: Complemental strand, 41191085 - 41190929
Alignment:
53 gtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcggattctttgataaccaccatggccaacttatgaaagatggcggtgcca- 151  Q
    |||||||| | |||||||  |||||||| ||||||||||||||||||||| |||| | | |||||  |||||||||| || |||| | |||||||||||     
41191085 gtgttgtcaaatattggt--tatggcgccgccatggtggattgcggtggcagattttcttataactgccatggccaatttgtgaagggtggcggtgccag 41190988  T
152 ---------tggcgtatttttggctttccaccgttgataactctggaaattacacccct 201  Q
             |||| |||||||||||||||||| ||||||||||||||||||||||||||    
41190987 gacgtcttatggcatatttttggctttccaccattgataactctggaaattacacccct 41190929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University