View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3902_high_15 (Length: 212)
Name: NF3902_high_15
Description: NF3902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3902_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 40603578 - 40603774
Alignment:
| Q |
5 |
gattcttggggaaattgcacataccaccgttagatattctgaattgaagtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40603578 |
gattcttggggaaattgcacataccaccgttagatattctgaattgaagtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcgg |
40603677 |
T |
 |
| Q |
105 |
attctttgataaccaccatggccaacttatgaaagatggcggtgccatggcgtatttttggctttccaccgttgataactctggaaattacacccct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40603678 |
attctttgataaccaccatggccaacttatgaaagatggcggcgccatagcgtatttttggctttccacagttgataactctggaaattacacccct |
40603774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 53 - 201
Target Start/End: Complemental strand, 41191085 - 41190929
Alignment:
| Q |
53 |
gtgttgtccattattggtcatatggcgctgccatggtggattgcggtggcggattctttgataaccaccatggccaacttatgaaagatggcggtgcca- |
151 |
Q |
| |
|
|||||||| | ||||||| |||||||| ||||||||||||||||||||| |||| | | ||||| |||||||||| || |||| | ||||||||||| |
|
|
| T |
41191085 |
gtgttgtcaaatattggt--tatggcgccgccatggtggattgcggtggcagattttcttataactgccatggccaatttgtgaagggtggcggtgccag |
41190988 |
T |
 |
| Q |
152 |
---------tggcgtatttttggctttccaccgttgataactctggaaattacacccct |
201 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41190987 |
gacgtcttatggcatatttttggctttccaccattgataactctggaaattacacccct |
41190929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University