View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3902_low_14 (Length: 224)
Name: NF3902_low_14
Description: NF3902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3902_low_14 |
 |  |
|
| [»] chr5 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 115 - 224
Target Start/End: Original strand, 40603323 - 40603432
Alignment:
| Q |
115 |
atagtgaaatcgatgatcctgttatatgagttcagggtttttgtttgtgtagtttcgggttttgatgggtagagaagatttgctatatgctaaagaaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40603323 |
atagtgaaatcgatgatcctgttatatgagttcagggtttttgtttgtgtagtttcgggttttgatgggtagagaagatttgctatatgctaaagaaatt |
40603422 |
T |
 |
| Q |
215 |
tctcaagtgt |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
40603423 |
tctcaagtgt |
40603432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 6 - 77
Target Start/End: Original strand, 40603213 - 40603284
Alignment:
| Q |
6 |
atagaggattttctatatggttaaaactagctgaattcatgatactgtagggctttaatctgttaatatcca |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40603213 |
atagaggattttctatatggttaaaactagctgaattcatgatactgtagggttttaatctgttaatatcca |
40603284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 40603429 - 40603485
Alignment:
| Q |
161 |
gtgtagtttcgggttttgatgggtagagaagatttgctatatgctaaagaaatttct |
217 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40603429 |
gtgtagttttgggttttgatgtgtatagaagatttgctatatgctaaagaaatttct |
40603485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 41191450 - 41191382
Alignment:
| Q |
8 |
agaggattttctatatggttaaaactagctgaattcatgatactgtagggctttaatctgttaatatcc |
76 |
Q |
| |
|
|||||||||||||| |||| |||| ||||| ||||||||||||| ||||| |||| | ||||||||||| |
|
|
| T |
41191450 |
agaggattttctatttggtaaaaagtagctaaattcatgatactctagggatttactttgttaatatcc |
41191382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 180
Target Start/End: Complemental strand, 41191344 - 41191276
Alignment:
| Q |
115 |
atagtgaaatcgatgatcctgttatat---gagttcagggtttttgtttgtgtagtttcgggttttgat |
180 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
41191344 |
atagtcaaatctgtgatcctgttatatttagagttcagggtttctgtttgtgtagtttagcgttttgat |
41191276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University