View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3903_high_6 (Length: 213)

Name: NF3903_high_6
Description: NF3903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3903_high_6
NF3903_high_6
[»] chr8 (1 HSPs)
chr8 (1-198)||(31278130-31278316)
[»] chr4 (1 HSPs)
chr4 (84-140)||(197325-197381)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 31278316 - 31278130
Alignment:
1 atcattatgtgaaaaaattaagtttcaattgtattgctagttgaaaacgaaatatattacttttgttttttaatactattattggtgtcttaatcccatt 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||    
31278316 atcattatgtgaaaaaattaagtttcaattgtattgatagttgaaaacgaaatatattactttcgttttttaatactattagtggtgtcttaatcccatt 31278217  T
101 ccgtgtttaaaaattgtttcataattgttttcctttgttgtcccatcattgtttagttttgtgatgtaacattgtaagctcttgtcgtgtcttcttgt 198  Q
    |||||||||           | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31278216 ccgtgttta-----------acaattgttttccgttgttgtcccatcattgtttagttttgtgatgtaacattgtaagctcttgtcgtgtcttcttgt 31278130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 140
Target Start/End: Original strand, 197325 - 197381
Alignment:
84 ggtgtcttaatcccattccgtgtttaaaaattgtttcataattgttttcctttgttg 140  Q
    |||| ||||| ||| ||| |||||||| | |||||||||| ||||||||||||||||    
197325 ggtgacttaacccccttcagtgtttaatagttgtttcatagttgttttcctttgttg 197381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University