View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3903_high_6 (Length: 213)
Name: NF3903_high_6
Description: NF3903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3903_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 31278316 - 31278130
Alignment:
| Q |
1 |
atcattatgtgaaaaaattaagtttcaattgtattgctagttgaaaacgaaatatattacttttgttttttaatactattattggtgtcttaatcccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31278316 |
atcattatgtgaaaaaattaagtttcaattgtattgatagttgaaaacgaaatatattactttcgttttttaatactattagtggtgtcttaatcccatt |
31278217 |
T |
|
| Q |
101 |
ccgtgtttaaaaattgtttcataattgttttcctttgttgtcccatcattgtttagttttgtgatgtaacattgtaagctcttgtcgtgtcttcttgt |
198 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31278216 |
ccgtgttta-----------acaattgttttccgttgttgtcccatcattgtttagttttgtgatgtaacattgtaagctcttgtcgtgtcttcttgt |
31278130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 140
Target Start/End: Original strand, 197325 - 197381
Alignment:
| Q |
84 |
ggtgtcttaatcccattccgtgtttaaaaattgtttcataattgttttcctttgttg |
140 |
Q |
| |
|
|||| ||||| ||| ||| |||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
197325 |
ggtgacttaacccccttcagtgtttaatagttgtttcatagttgttttcctttgttg |
197381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University