View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3904_high_15 (Length: 271)

Name: NF3904_high_15
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3904_high_15
NF3904_high_15
[»] chr1 (1 HSPs)
chr1 (18-254)||(8180445-8180680)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 8180680 - 8180445
Alignment:
18 gaagaggccagagtcatcatagtttagtatagaataatgcatgttatgccatcnnnnnnnncccactttatttgtctctctctttgcataatcaaataaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||    
8180680 gaagaggccagagtcatcatagtttagtatagaataatgcatgttatgccatcttttttt-cccactttatttgtctctctctttgcataatcaaataaa 8180582  T
118 tatggttgatgttgtttttacctgagaaatttgtgaggaaaatttgtgaggattgctagaaaggtgtccgagagaatcaatcatacgaccaaacaaaaca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8180581 tatggttgatgttgtttttacctgagaaatttgtgaggaaaatttgtgaggattgctagaaaggtgtccgagagaatcaatcatacgaccaaacaaaaca 8180482  T
218 aaggaaacaggaagagcagcaccatgaacaaaagaac 254  Q
    |||||||||||||||||||||||||||||||||||||    
8180481 aaggaaacaggaagagcagcaccatgaacaaaagaac 8180445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University