View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_high_16 (Length: 268)
Name: NF3904_high_16
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_high_16 |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
| [»] scaffold0312 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 50246565 - 50246366
Alignment:
| Q |
1 |
atctagatgtttctttatataaaatcatagattattagtccgcagccgcgcaagttgcatgagaaagatacttgtcaactgagataattcannnnnnnna |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
50246565 |
atctagatgtttctttatataaaatcatagattattagtccgcagccgcgcaagttgcatgtgaaagatacttgtcaactgagataattcatttttttta |
50246466 |
T |
 |
| Q |
101 |
tagggtcgtgaacgtgaagtatcatgcatcatccaggggaagccgcgtattattttcgtgtaaagttgttaagtatccaacttttttcttcttcttgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50246465 |
tagggtcgtgaacgtgaagtatcatgcatcatccaggggaagccgcgtattattttcgtgtaaagttgttaagtatccaactcttttcttcttcttgcat |
50246366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 252
Target Start/End: Original strand, 17272005 - 17272057
Alignment:
| Q |
200 |
ttattaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||| |||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
17272005 |
ttataaggaaaattctatggtgaagtcgtgggaatgacttttctggtgaagtt |
17272057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 29584410 - 29584363
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
29584410 |
aggaaaattctatggtgaagtcgtgggaatgacttttctggtgaagtt |
29584363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 35021247 - 35021200
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
35021247 |
aggaaaattctatggtgaagtcatgaaaatgacttttctggtgaagtt |
35021200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 38812309 - 38812262
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
38812309 |
aggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
38812262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 54995848 - 54995801
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
54995848 |
aggaaaattctacgatgaagtcatgataatgacttttttggtgaagtt |
54995801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 251
Target Start/End: Original strand, 32579443 - 32579489
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||||||| |||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
32579443 |
aggaaaattttatggtgaagttctgagaatgacttttctggtgaagt |
32579489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 28003197 - 28003152
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
28003197 |
ggaaaattctatggtgaagtcatgagaatgacttttctggtgaagt |
28003152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 20097537 - 20097493
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
20097537 |
aaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
20097493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 27396618 - 27396662
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
27396618 |
aaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
27396662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 12186 - 12140
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12186 |
ggaaaattctatgatgaagttatgagaatgacttttctggtgaagtt |
12140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 35844316 - 35844363
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
35844316 |
aggaaaattctatggtgaagtcatgataatgacttttctggtgaagtt |
35844363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 40640683 - 40640636
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
40640683 |
aggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
40640636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 42665590 - 42665543
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |||| |||||||||| |
|
|
| T |
42665590 |
aggaaaattctatggtgaagttatgataatgatttttttggtgaagtt |
42665543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 252
Target Start/End: Complemental strand, 7327671 - 7327622
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||| | |||||||| |
|
|
| T |
7327671 |
ttaggaaaattctatggtgaagttatgagaatgacttttttagtgaagtt |
7327622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 19606961 - 19606916
Alignment:
| Q |
207 |
gaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||| ||||||| | | ||||||||||||||||||||| |
|
|
| T |
19606961 |
gaaaattctatggtgaagttataaaaatgacttttctggtgaagtt |
19606916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 252
Target Start/End: Complemental strand, 45879549 - 45879500
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||||||||||||| ||||| |
|
|
| T |
45879549 |
ttaggaaaattctatgctgaagtcatgagaatgacttttctggtaaagtt |
45879500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 252
Target Start/End: Original strand, 11466813 - 11466861
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||||||||| ||||||| |
|
|
| T |
11466813 |
taggaaaattctatggtgaagtcttgagaatgacttttctgatgaagtt |
11466861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 44186688 - 44186640
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||||| | || ||||| |||| |||||||||| |
|
|
| T |
44186688 |
taggaaaattctatgatgaagtcgagagaatgatttttttggtgaagtt |
44186640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 46297945 - 46297901
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
46297945 |
aaaattctatggtgaagtcatgaaaatgacttttctggtgaagtt |
46297901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 33902068 - 33902114
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
33902068 |
ggaaaattctatgatgaagtcgttagaatgacttttctggtgaagtt |
33902114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 4763628 - 4763674
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
4763628 |
ggaaaattctatgatgaagtcatgaaaatgacttttctgatgaagtt |
4763674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 31861895 - 31861941
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||| |||||||||| |
|
|
| T |
31861895 |
ggaaaattctatggtgaagttatgagaatgacttttttggtgaagtt |
31861941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 41465509 - 41465555
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
41465509 |
ggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
41465555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 4264282 - 4264234
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
4264282 |
taggaaaattctatggtgaagtcatcataatgacttttctggtaaagtt |
4264234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 31570938 - 31570894
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaa |
249 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||| |||||||||||||| |
|
|
| T |
31570938 |
aggaaaattctatggtgaagttatgagaataacttttctggtgaa |
31570894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 41643874 - 41643918
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
41643874 |
aaaattctatggtgaagtcatgataatgacttttttggtgaagtt |
41643918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 4150536 - 4150490
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
4150536 |
aggaaaattctatggtgaagtcatgataatgacttttctggtgaagt |
4150490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 13876969 - 13876921
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||| |||||||||| |
|
|
| T |
13876969 |
taggaaaattctatggtgaagttatgaaaatgacttttatggtgaagtt |
13876921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 1547282 - 1547329
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
1547282 |
aggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
1547329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 252
Target Start/End: Complemental strand, 27533155 - 27533114
Alignment:
| Q |
211 |
attctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
27533155 |
attctatgataaagttatgagaatgacttttctggtgaagtt |
27533114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 252
Target Start/End: Original strand, 30254413 - 30254466
Alignment:
| Q |
199 |
attattaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||| ||||||| | | |||||||||| || ||||||| |
|
|
| T |
30254413 |
attattaggaaaattctatggtgaagttataagaatgacttttttgttgaagtt |
30254466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 252
Target Start/End: Original strand, 30254847 - 30254900
Alignment:
| Q |
199 |
attattaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||| |||||| | |||||||||||| || ||||||| |
|
|
| T |
30254847 |
attattaggaaaattctatggtgaagtcataataatgacttttttgatgaagtt |
30254900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 421387 - 421423
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgactttt |
241 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
421387 |
aggaaaattctatgatgaagttatgagaatgactttt |
421423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 252
Target Start/End: Original strand, 2959742 - 2959790
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||||||||| ||||||| |
|
|
| T |
2959742 |
taggaaaattctatggtgaagtcatgaaaatgacttttctgatgaagtt |
2959790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 22980794 - 22980839
Alignment:
| Q |
207 |
gaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22980794 |
gaaaattttatgatgaagttatgagaatgacttttctggtgaagtt |
22980839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 8466744 - 8466791
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
8466744 |
aggaaaattctatgatgaggtcatgagaatgacttttctggtgaagtt |
8466791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Complemental strand, 8742063 - 8742016
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
8742063 |
aggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
8742016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 22616493 - 22616540
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
22616493 |
aggaaaattctatggtgaagtcatgaaaatgacttttctggtgaagtt |
22616540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 27330305 - 27330352
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
27330305 |
aggaaaattctatggtgaagtcgtgggaatgacttttctggtgaagtt |
27330352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 15724490 - 15724536
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||| |||||||||| |
|
|
| T |
15724490 |
ggaaaattctatggtgaagttatgagaatgacttttttggtgaagtt |
15724536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 26317859 - 26317813
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
26317859 |
ggaaaattctatgatgaagtcatgaaaatgacttttttggtgaagtt |
26317813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 252
Target Start/End: Complemental strand, 25501107 - 25501055
Alignment:
| Q |
200 |
ttattaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||| ||||||||||| |||||| ||| ||||||||||||||| ||||| |
|
|
| T |
25501107 |
ttattagaaaaattctatggtgaagtcatgagaatgacttttctggtaaagtt |
25501055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 1835440 - 1835392
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||| ||||||||| |
|
|
| T |
1835440 |
ttaggaaaattctatggtgaagttgttagaatgacttttttggtgaagt |
1835392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 1879281 - 1879233
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||| ||||||||| |
|
|
| T |
1879281 |
ttaggaaaattctatggtgaagttgttagaatgacttttttggtgaagt |
1879233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 251
Target Start/End: Complemental strand, 6446752 - 6446709
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
6446752 |
aaaattctatggtgaagtcatgataatgacttttctggtgaagt |
6446709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 28221003 - 28220957
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
28221003 |
ggaaaattctatgataaagtcatgaaaatgacttttctggtgaagtt |
28220957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 252
Target Start/End: Original strand, 41362517 - 41362563
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||| |||||||||| |
|
|
| T |
41362517 |
ggaaaattctatggtgaagttatgaaaatgacttttttggtgaagtt |
41362563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 243
Target Start/End: Complemental strand, 1954145 - 1954108
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttct |
243 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1954145 |
ggaaaattctatggtgaagttatgataatgacttttct |
1954108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 251
Target Start/End: Original strand, 33906223 - 33906268
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||||||||||| |||| || ||| |||||||||||||||||||| |
|
|
| T |
33906223 |
ggaaaattctatggtgaaattatgagaatgacttttctggtgaagt |
33906268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 3953733 - 3953777
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3953733 |
aaaattctatgatgaagtcatgagaatgacttttctggtgaagtt |
3953777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 40381939 - 40381986
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||| | ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40381939 |
aggaaaattctacggtgaagttatgagaatgacttttctggtgaagtt |
40381986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 10359400 - 10359360
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggt |
246 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
10359400 |
ggaaaattctatggtgaagtcatgataatgacttttctggt |
10359360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 27421563 - 27421519
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| |||||||||| |||| |||||||||| |
|
|
| T |
27421563 |
aaaattctatggtgaagtcgtgataatgatttttttggtgaagtt |
27421519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 30338478 - 30338522
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | |||||||| |
|
|
| T |
30338478 |
aaaattctatgatgaagttgtgagaatgacttttttagtgaagtt |
30338522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 252
Target Start/End: Original strand, 8513232 - 8513279
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
8513232 |
aggaaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
8513279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 7235218 - 7235173
Alignment:
| Q |
206 |
ggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||| |||||||| |
|
|
| T |
7235218 |
ggaaaattctatggtgaagttatgagaatgacttttccggtgaagt |
7235173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 3880125 - 3880077
Alignment:
| Q |
204 |
taggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
3880125 |
taggaaaattctatggtgaagtcacgagaatgacttttctggtgaagtt |
3880077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 20768087 - 20768131
Alignment:
| Q |
207 |
gaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
20768087 |
gaaaattctatggtgaagtcatgagaatgacttttctggtgaagt |
20768131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 251
Target Start/End: Original strand, 25440955 - 25441003
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
||||| |||||||||| |||||| || | |||||||||||||||||||| |
|
|
| T |
25440955 |
ttagggaaattctatggtgaagtcgttaaaatgacttttctggtgaagt |
25441003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 30353540 - 30353496
Alignment:
| Q |
208 |
aaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
30353540 |
aaaattctatggtgaagtcatgagaatgacttttctggtgaagtt |
30353496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 9184 - 9138
Alignment:
| Q |
205 |
aggaaaattctatgatgaagttgtgataatgacttttctggtgaagt |
251 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| || |||||| |
|
|
| T |
9184 |
aggaaaattctatgatgaagttatgagaatgacttttttgctgaagt |
9138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 252
Target Start/End: Original strand, 131 - 180
Alignment:
| Q |
203 |
ttaggaaaattctatgatgaagttgtgataatgacttttctggtgaagtt |
252 |
Q |
| |
|
|||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
131 |
ttaggaaaattctatggtgaagtcacgaaaatgacttttctggtgaagtt |
180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University