View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_high_17 (Length: 249)
Name: NF3904_high_17
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 50246635 - 50246867
Alignment:
| Q |
8 |
tatataaattgacacacaccaccaccaccaagtttccattatagcactgtattgtgaagatggagcatcaaagtccggtagcactagttgtcggagttac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50246635 |
tatataaattgacacacaccaccaccaccaagtttccattatagcactgtattgtgaagatggagcatcaaagtccggtagcactagttgtcggagttac |
50246734 |
T |
|
| Q |
108 |
gggaatggttggactaagcttagccgaagccttgaagcagcctgattgtctcggaggtccatggaaagtttacggcggtgctcgccgttccccagacgaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50246735 |
gggaatggttggactaagcttagccgaagccttgaagcagcctgattgtctcggaggtccatggaaagtttacggcggtgctcgccattccccagacgaa |
50246834 |
T |
|
| Q |
208 |
tggttcccttcttccatcctagacggcttcatc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50246835 |
tggttcccttcttccatcctagacggcttcatc |
50246867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 67 - 239
Target Start/End: Original strand, 50253831 - 50254003
Alignment:
| Q |
67 |
atggagcatcaaagtccggtagcactagttgtcggagttacgggaatggttggactaagcttagccgaagccttgaagcagcctgattgtctcggaggtc |
166 |
Q |
| |
|
|||| |||||||||||| ||||||||||| || ||||| |||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50253831 |
atggcgcatcaaagtcccgtagcactagtagttggagtaacgggaatggctggcctaagcttagccaaagccttgaagcagcctgattgtctcggaggtc |
50253930 |
T |
|
| Q |
167 |
catggaaagtttacggcggtgctcgccgttccccagacgaatggttcccttcttccatcctagacggcttcat |
239 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| || ||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
50253931 |
catggaaagtttatggcgcagctcgccattcccccgatgaatggttcccttcttccatcctcgacagcttcat |
50254003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 85 - 240
Target Start/End: Complemental strand, 27644179 - 27644024
Alignment:
| Q |
85 |
gtagcactagttgtcggagttacgggaatggttggactaagcttagccgaagccttgaagcagcctgattgtctcggaggtccatggaaagtttacggcg |
184 |
Q |
| |
|
||||||||||| || ||||| |||||||||| ||| |||||| ||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||| | |
|
|
| T |
27644179 |
gtagcactagtggttggagtaacgggaatggctgggctaagcctagccaaagccttgaagcagcctgattgtcttggaggcccatggaaagtttacggtg |
27644080 |
T |
|
| Q |
185 |
gtgctcgccgttccccagacgaatggttcccttcttccatcctagacggcttcatc |
240 |
Q |
| |
|
|||||||| ||| | |||| ||||| || ||||||||||| || ||||||||| |
|
|
| T |
27644079 |
cagctcgccgctccgccgacggctggtttccctcttccatccttgatggcttcatc |
27644024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University