View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_high_20 (Length: 225)
Name: NF3904_high_20
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 34662013 - 34661952
Alignment:
| Q |
149 |
ttctatctattaacaattcttcaagcaagaatagcttgttggattggaatttggaccctatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34662013 |
ttctatctattaacaattcttcaagcaagaatagcttgttggattggaatttggaccctatg |
34661952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 34662050 - 34662010
Alignment:
| Q |
19 |
cttagatgttttaattattattgattagtgtgatcttttct |
59 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34662050 |
cttagatgttttaattattaatgattagtgtgatcttttct |
34662010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University