View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3904_high_20 (Length: 225)

Name: NF3904_high_20
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3904_high_20
NF3904_high_20
[»] chr4 (2 HSPs)
chr4 (149-210)||(34661952-34662013)
chr4 (19-59)||(34662010-34662050)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 34662013 - 34661952
Alignment:
149 ttctatctattaacaattcttcaagcaagaatagcttgttggattggaatttggaccctatg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34662013 ttctatctattaacaattcttcaagcaagaatagcttgttggattggaatttggaccctatg 34661952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 34662050 - 34662010
Alignment:
19 cttagatgttttaattattattgattagtgtgatcttttct 59  Q
    |||||||||||||||||||| ||||||||||||||||||||    
34662050 cttagatgttttaattattaatgattagtgtgatcttttct 34662010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University