View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_low_11 (Length: 404)
Name: NF3904_low_11
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 7e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 202 - 388
Target Start/End: Original strand, 3285952 - 3286138
Alignment:
| Q |
202 |
atgatcatctctttgtacatttagtggggcccctattggactccaaccattctcaacaacatgctcctctgttcctagtaccattaccatcactgttcct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3285952 |
atgatcatctctttgtacatttagtggggcccctattggactccaaccattctcaacaacatgctcctctgttccgagtaccattaccatcactgttcct |
3286051 |
T |
|
| Q |
302 |
ttgctcttttttcaccttttccagttttacccttcttctcttaccataataattatgattctcttcactcttcagtgttcacctttg |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3286052 |
ttgctcttttttcaccttttccagttttacccttcttctcttaccataataattatgattctcttcactcttcagtgttcacctttg |
3286138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 22 - 156
Target Start/End: Original strand, 3285769 - 3285903
Alignment:
| Q |
22 |
ccggcgaagattaggaaacaaagcttgtgaagaaggtgcaagaaacctttcaaaaatggccatgagtaagaacattgaaataagaacagcagtagcaaca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285769 |
ccggcgaagattaggaaacaaagcttgtgaagaaggtgcaagaaacctttcaaaaatggccatgagtaagaacattgaaataagaacagcagtagcaaca |
3285868 |
T |
|
| Q |
122 |
aaaccaaaggagacagcattaacagaactatcaaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285869 |
aaaccaaaggagacagcattaacagaactatcaaa |
3285903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University