View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_low_15 (Length: 271)
Name: NF3904_low_15
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 8180680 - 8180445
Alignment:
| Q |
18 |
gaagaggccagagtcatcatagtttagtatagaataatgcatgttatgccatcnnnnnnnncccactttatttgtctctctctttgcataatcaaataaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8180680 |
gaagaggccagagtcatcatagtttagtatagaataatgcatgttatgccatcttttttt-cccactttatttgtctctctctttgcataatcaaataaa |
8180582 |
T |
|
| Q |
118 |
tatggttgatgttgtttttacctgagaaatttgtgaggaaaatttgtgaggattgctagaaaggtgtccgagagaatcaatcatacgaccaaacaaaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8180581 |
tatggttgatgttgtttttacctgagaaatttgtgaggaaaatttgtgaggattgctagaaaggtgtccgagagaatcaatcatacgaccaaacaaaaca |
8180482 |
T |
|
| Q |
218 |
aaggaaacaggaagagcagcaccatgaacaaaagaac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8180481 |
aaggaaacaggaagagcagcaccatgaacaaaagaac |
8180445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University