View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_low_19 (Length: 231)
Name: NF3904_low_19
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 43070398 - 43070203
Alignment:
| Q |
20 |
ctatcttcacccctttgcgatttttcttccacttctccctgtgtagctaatttgatttttatttatttaacgttgctagtttattttgattaggctagga |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43070398 |
ctatcttcacccctttacgatttttcttccacttctccttgtgtagctaatttgatttttatttatttaacgttgctagtttattttgattaggctagga |
43070299 |
T |
 |
| Q |
120 |
aggatatatatgaactctctaaaatcctgatgtaatgtgaacaattcttattcaatacatgtttataatcacatggtgactatcgtcccttcctcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43070298 |
aggatatatatgaactctctaaaatcctgatgtaatgtgaacaattcttattcaatacatgtttataatcacatggtgactatcgtcccttcctcc |
43070203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University