View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3904_low_2 (Length: 669)
Name: NF3904_low_2
Description: NF3904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3904_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 8e-72; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 8e-72
Query Start/End: Original strand, 30 - 274
Target Start/End: Complemental strand, 42089609 - 42089372
Alignment:
| Q |
30 |
gaaagagatagtgagagatgatagaacctgcggtatttgtctttctgcttttgcttcggaaataccactctccagggaaatagtagtagcaccaccccag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42089609 |
gaaagagatagtgagagatgatagaacctgcggtatttgtctttctgcttttgcttcggaaataccactctccagggaaatagtagtagcacca-cccag |
42089511 |
T |
|
| Q |
130 |
tcccaccatgggctttctaacnnnnnnnnnnnnnnnnnnnnnnatataataatgctatagcaatgcagcatctactctatctatctataggaacagcgtg |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
42089510 |
tcccaccatgggctttctaac-tttttttttatttttatttttatataataatgctatagcaatgcagcatctactctatctacctataggaactgcgtg |
42089412 |
T |
|
| Q |
230 |
acagtatagtatagagtattactacaatagtataattatattaaa |
274 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42089411 |
acagtatagtatagagtatt-----aatagtataattatattaaa |
42089372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 344 - 465
Target Start/End: Complemental strand, 42089300 - 42089179
Alignment:
| Q |
344 |
gatgaaactgtcttctgcagagtgcacatataattttgcagggttatgaagactgacaaatggagttttgatccgacactgcagttctatttcagtagct |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089300 |
gatgaaactgtcttctgcagagtgcacatatatttttgcagagttatgaagactgacaaatggagttttgatccgacactgcagttctatttcagtagct |
42089201 |
T |
|
| Q |
444 |
gagaagattatcaaaacatttt |
465 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
42089200 |
gagaagattatcaaaagatttt |
42089179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 624 - 668
Target Start/End: Complemental strand, 42088947 - 42088903
Alignment:
| Q |
624 |
caaatagtacaattgaatatgaatataatactcgattaggatatg |
668 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42088947 |
caaatagtacaattgaatatgaatataatactcgattaggatatg |
42088903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 479 - 514
Target Start/End: Complemental strand, 42089141 - 42089106
Alignment:
| Q |
479 |
agagttgcagattttgactttgctatcattggagtt |
514 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089141 |
agagttgcagattttgactttgctatcattggagtt |
42089106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University