View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3905_high_11 (Length: 344)
Name: NF3905_high_11
Description: NF3905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3905_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 14 - 110
Target Start/End: Original strand, 24949170 - 24949269
Alignment:
| Q |
14 |
gaagaagagtcaattaatattattagaattcaaatgtgatatggaactactattttttatggggataaagaaataatatacgt---ataatacgtaagtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24949170 |
gaagaagagtcaattaatattattagaattcaaatgtgatatggaactactattttttatggggataaagaaataatatacgtagaataatacgtaagtt |
24949269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 184 - 329
Target Start/End: Original strand, 24949345 - 24949482
Alignment:
| Q |
184 |
agaatttctcatcaatgtctaggtcaataatcatgtgatctgaccgatgatccactgatcagatcagtaacacactgacccagcgtcttgaccaggtcga |
283 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
24949345 |
agaatttctcatcaatgtctcggtcaatagtcatgggatccgaccgatgatccactgattagatcagtaaca--------cagcgtcttgaccagatcga |
24949436 |
T |
 |
| Q |
284 |
tcagcgctcggagttttaaaacacatgttcatcccaacatagattc |
329 |
Q |
| |
|
||| || || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949437 |
tcaccgatccgagttttaaaacacatgttcatcccaacatagattc |
24949482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University