View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3905_high_21 (Length: 235)
Name: NF3905_high_21
Description: NF3905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3905_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 34574198 - 34574387
Alignment:
| Q |
22 |
ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcaccactctaagatatcatttttgtgactcata---tatcataatgatttacgtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34574198 |
ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcattactctaagatatcatttttgtgactcataatatatcataatgatttacgtt |
34574297 |
T |
 |
| Q |
119 |
gtgactcaacttttgcttagaaaaagtttgttttcgtgtagctttgtgtgtttctgttataggaaacttcaaaattgaagtataacgata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34574298 |
gtgactcaacttttgcttagaaaaagtttgttttcgtgtagctttgtgtgtttctgttataggaaacttcaaaattgaagtataacgata |
34574387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University