View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3905_low_13 (Length: 344)

Name: NF3905_low_13
Description: NF3905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3905_low_13
NF3905_low_13
[»] chr7 (2 HSPs)
chr7 (14-110)||(24949170-24949269)
chr7 (184-329)||(24949345-24949482)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 14 - 110
Target Start/End: Original strand, 24949170 - 24949269
Alignment:
14 gaagaagagtcaattaatattattagaattcaaatgtgatatggaactactattttttatggggataaagaaataatatacgt---ataatacgtaagtt 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||    
24949170 gaagaagagtcaattaatattattagaattcaaatgtgatatggaactactattttttatggggataaagaaataatatacgtagaataatacgtaagtt 24949269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 184 - 329
Target Start/End: Original strand, 24949345 - 24949482
Alignment:
184 agaatttctcatcaatgtctaggtcaataatcatgtgatctgaccgatgatccactgatcagatcagtaacacactgacccagcgtcttgaccaggtcga 283  Q
    |||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||| ||||||||||||        ||||||||||||||| ||||    
24949345 agaatttctcatcaatgtctcggtcaatagtcatgggatccgaccgatgatccactgattagatcagtaaca--------cagcgtcttgaccagatcga 24949436  T
284 tcagcgctcggagttttaaaacacatgttcatcccaacatagattc 329  Q
    ||| || || ||||||||||||||||||||||||||||||||||||    
24949437 tcaccgatccgagttttaaaacacatgttcatcccaacatagattc 24949482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University