View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_high_11 (Length: 495)
Name: NF3906_high_11
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 206 - 450
Target Start/End: Complemental strand, 12674429 - 12674189
Alignment:
| Q |
206 |
ataaaaagtgcatgttttctatgcaacacgcaatcaatgtctttgactgtccttcttccttgtttctgcacattcaactccttcaattcaaataagtcca |
305 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12674429 |
ataaaaagtgcatgtgttctatgcaacacgcaatcaatgtctttgactgtccttcttccttgtttctgcacattcaactccttcaattcaaataagtcga |
12674330 |
T |
|
| Q |
306 |
catctgcaaaacagatacaacaacagtggcaacaaagtgatgacccctgccaccaattttagaacgaaatggggaaactgattttgcgtctccgtaatgg |
405 |
Q |
| |
|
||| |||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12674329 |
catgtgcaaaacagat---ataacagtggcaacaaagtgatgacccctaccaccaattttagaacgaaatggggaaactgattttgcgtctccgtaatgg |
12674233 |
T |
|
| Q |
406 |
gatcccagattttattatcggcaccatggaactggaggaaacgag |
450 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12674232 |
gat-ccagattttattatcggcaccatggaactggaggaaacgag |
12674189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 12675137 - 12675088
Alignment:
| Q |
5 |
gatcgtccaacacctcctccatatctagttgttatggttgtgtcaagtga |
54 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12675137 |
gatcgtccaacacctcctccatatctggttgttatggttgtgtcaagtga |
12675088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University