View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_high_13 (Length: 469)
Name: NF3906_high_13
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 8e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 8e-96
Query Start/End: Original strand, 86 - 324
Target Start/End: Complemental strand, 9465059 - 9464815
Alignment:
| Q |
86 |
gggtttgtcttcatttggtaaactttctatcctaattttatgacttttgtcaaagtttgatgctttttacaattttgaattatgggctgatcttatttcg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9465059 |
gggtttgtcttcatttggtaaactttctatcctaattttatgacttttgtcaaagtttgatgctttttacaattttgaattatgggctgatcttatttcg |
9464960 |
T |
 |
| Q |
186 |
atccatctaactaacccaattcagtaaatttt------gnnnnnnnnnnnnaaaaatttagacatcatagttttctgctaaagttgtctcaaaaaacata |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9464959 |
atccatctaactaacccaattcagtaaatttttgtttgtttttttttttaaaaaaatttagacatcatagttttctgctaaagttgtctcaaaaaacata |
9464860 |
T |
 |
| Q |
280 |
gatttggtcttttttgttgttgctgctgcatgtttaatcagcatt |
324 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9464859 |
gatttggtcttttttgttgttgttgctgcatgtttaatcagcatt |
9464815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 381 - 463
Target Start/End: Complemental strand, 9464758 - 9464676
Alignment:
| Q |
381 |
ataggacatagatacgaggttttgtgtttgtttggtgattgtatcatgtatgtaactgattggaatttggatctgatgatgtc |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9464758 |
ataggacatagatacgaggttttgtgtttgtttggtgattgtatcatgtatgtaactgattggaatttggatccgatgatgtc |
9464676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University