View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3906_high_25 (Length: 359)

Name: NF3906_high_25
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3906_high_25
NF3906_high_25
[»] chr7 (2 HSPs)
chr7 (17-135)||(6841893-6842011)
chr7 (253-323)||(6842128-6842198)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 6841893 - 6842011
Alignment:
17 tttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaagaattcagacattctccaactcctacg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6841893 tttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaagaattcagacattctccaactcctacg 6841992  T
117 tattcaattcactttgata 135  Q
    |||||||||||||||||||    
6841993 tattcaattcactttgata 6842011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 253 - 323
Target Start/End: Original strand, 6842128 - 6842198
Alignment:
253 ccatacaaataattcaaaaacagttcaatccgtttgtttgnnnnnnnnngtttaagtttggttaactgata 323  Q
    ||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
6842128 ccatacaaataattcaaaaacagttcaatccgtttgtttgtttttttttgtttaagtttggttaactgata 6842198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University