View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_high_46 (Length: 253)
Name: NF3906_high_46
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 7 - 142
Target Start/End: Original strand, 16233222 - 16233357
Alignment:
| Q |
7 |
catctctccctatcgctgactttaaaacgtgccaattcaggagtatcattttcttacctcttgtctgaccatattcttatggatttaataaattagatat |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
16233222 |
catctctccctattgctgactttaaaacgtgccaattcaggagcatcattttctcccctcttgtctgaccatattcttatcgatttaataatttatatat |
16233321 |
T |
 |
| Q |
107 |
atctttagaaataatattccaacatgtctaaatagt |
142 |
Q |
| |
|
|| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
16233322 |
atttttggaaataatattacaacatgtctaaatagt |
16233357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 141 - 207
Target Start/End: Original strand, 16233408 - 16233474
Alignment:
| Q |
141 |
gtcggtatccaactgtatttctttgttgacaaaatactaaagtatgttggacaattataaaatactc |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16233408 |
gtcggtatccaactgtatttctgtgttgacaaaatactaaagtatgttggacaattataaaatactc |
16233474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University