View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_high_54 (Length: 244)
Name: NF3906_high_54
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_high_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 3928762 - 3928973
Alignment:
| Q |
12 |
aattcttatgcaaggcatcttcaattaatagttgattagataagttcaaaatacataattagtctttggttaattagctagtttctttgttttcaagtaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3928762 |
aattcttatgcaaggcatcttcaattaatagttgattagataagttcaaaatacataattagtctttggttgattagctagtttctttgttttcaagtaa |
3928861 |
T |
|
| Q |
112 |
attgccaaaatggtgaagataggttttggtacatttgatgactcttttagtgctgcctcccttaaggcttatctatcagagttcattgccactctgattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3928862 |
attgccaaaatggtgaagataggttttggtacatttgatgactcttttagtgctgcctcccttaaggcttatctatcagagttcattgccactctgattt |
3928961 |
T |
|
| Q |
212 |
ttgtgttcgctg |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3928962 |
ttgtgttcgctg |
3928973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University