View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_26 (Length: 359)
Name: NF3906_low_26
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 6841893 - 6842011
Alignment:
| Q |
17 |
tttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaagaattcagacattctccaactcctacg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6841893 |
tttggtctagatagaagagaaagagaatgaacactgatgaacgaagtagaagatagattcccgccaaacacaagaattcagacattctccaactcctacg |
6841992 |
T |
 |
| Q |
117 |
tattcaattcactttgata |
135 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6841993 |
tattcaattcactttgata |
6842011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 253 - 323
Target Start/End: Original strand, 6842128 - 6842198
Alignment:
| Q |
253 |
ccatacaaataattcaaaaacagttcaatccgtttgtttgnnnnnnnnngtttaagtttggttaactgata |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6842128 |
ccatacaaataattcaaaaacagttcaatccgtttgtttgtttttttttgtttaagtttggttaactgata |
6842198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University