View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_28 (Length: 347)
Name: NF3906_low_28
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 11359303 - 11359502
Alignment:
| Q |
19 |
gataaatcattgcttctccactccatggtggtttatcgtgccacactctacatagcttatagctcattgaatttcctttaaagaaaa-catcattgattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11359303 |
gataaatcattgcttctccactccatggtgatttatcgtgccacactctacatagcttatagctcattgaatttcctttaaagaaaaacatcattgattc |
11359402 |
T |
 |
| Q |
118 |
tgactatctttggtaagtaagtcttgcatagtcacatattatggacacaagtttaggcacactcccctcaaaaaataatttaggcacactcacatgaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11359403 |
tgactatctttggtaagtaagtcttgcatagtcacatattatggacacaagtttaggcacactcccctcaaaaaataatttaggcacactcacatgaaac |
11359502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 284 - 339
Target Start/End: Original strand, 11359569 - 11359624
Alignment:
| Q |
284 |
ccttgtgatgtgtctaaaagaattatatttagtgttgtgactatagaagaataatc |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11359569 |
ccttgtgatgtgtctaaaagaattatatttagtgttgtgactattgaagaataatc |
11359624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University