View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_32 (Length: 336)
Name: NF3906_low_32
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_32 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 9 - 318
Target Start/End: Original strand, 44993 - 45304
Alignment:
| Q |
9 |
gatgaacaattaatggttagactttactaatctttcatccgaattccgatttactagggctcttttcccctatgctccggagagttgatacnnnnnnnnn |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44993 |
gatgaacaattaatggttagactttactaatctttcatccgaattccgatttactagggctcttttcccctatgctccggagagttgatacaaaaacaaa |
45092 |
T |
 |
| Q |
109 |
nnnctagatctttgaaatttgtctaaattaaatagtcaaaagggacaatttattcaaaataaaatactattttattcttttacaaaatataaaaccaaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45093 |
aaactagatctttgaaatttgtctaaattcaatagtcaaaagggacaatttattcaaaataaaatactattttattcttttacaaaatatgaaaccaaaa |
45192 |
T |
 |
| Q |
209 |
caataagaagtatgaagaggatatatataattgca-tttgaatacagactcatatgaaaggtaaaatgttacagttacctttggggatag-ttgaccaat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45193 |
caataagaagtatgaagaggatatatataattgcattttgaatacagactcatatgaaaggtaaaatgttacagttacctttggggatagtttgaccaat |
45292 |
T |
 |
| Q |
307 |
ttcaggacttgc |
318 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45293 |
ttcaggacttgc |
45304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 334286 - 334330
Alignment:
| Q |
9 |
gatgaacaattaatggttagactttactaatctttcatccgaatt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334286 |
gatgaacaattaatggttagactttactaatctttcatccgaatt |
334330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University