View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_39 (Length: 307)
Name: NF3906_low_39
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 68 - 166
Target Start/End: Original strand, 31008636 - 31008734
Alignment:
| Q |
68 |
atggttgtatctttatgtttgtcaatattttgttagttcatattttatgtgtttttaatttcatggaagttaaatgcatgttgttggcttcaaaagttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31008636 |
atggttgtatctttatgtttgtcaatattttattagttcatattttatgtatttttaatttcatggaagttaaatgcatgttgttggcttcaaaagttt |
31008734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 279
Target Start/End: Original strand, 31008808 - 31008849
Alignment:
| Q |
238 |
aatggcagtaagttctttcaacttcatatgtaaacagtttaa |
279 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31008808 |
aatggcagtaagtactttcaacttcatatgtaaacagtttaa |
31008849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University