View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_42 (Length: 269)
Name: NF3906_low_42
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 7460797 - 7460537
Alignment:
| Q |
1 |
attcattgttatatttttgtgtcttttgttactaactgtctcaatctctctttgtttctaataacactcacttgctatcctaaaagattgagaactttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7460797 |
attcattgttatatttttgtgtcttttgttactaactgtctcaatctctctttgtttctaataacactcacttgctatcctaaaagattgagaactttgt |
7460698 |
T |
 |
| Q |
101 |
ttttggagacaacata---agggcttgtatgtatttataatagggtgaaataatgttgcgtgtcgtcttaggcttagtgatgaaggctatgaaagtgcct |
197 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7460697 |
ttttggagacaacataattagggcttgaatgtatttatagtagggtga---aatgttgcgtgtcgtcttagccttagtgatgaaggctatgaaagtgcct |
7460601 |
T |
 |
| Q |
198 |
catattgtgttctaatttgcagatggtgccattctt-ttattttattttattaagtagtattat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||| ||||||||||| ||||||| |
|
|
| T |
7460600 |
catattgtgttctaatttgcagatggtgccattcttattttttttttttattaagtggtattat |
7460537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 7445853 - 7445771
Alignment:
| Q |
1 |
attcattgttatatttttgtgtcttttgttactaactgtctcaatctctctttgtttctaataacactcacttgctatcctaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7445853 |
attcattgttatatttttgtgtcttttgttactaactgtctcaatctctctttgtttctaataacactcacttgctatcctaa |
7445771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University