View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_51 (Length: 249)
Name: NF3906_low_51
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_51 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 23868004 - 23867767
Alignment:
| Q |
9 |
gagatgaaactggtggtgtggaagacacattgttggaaggactgattgctggtgaaaccgaagaagacggtggctgaacagccggagacttcgccggtgg |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23868004 |
gagatgaaaccggtggtgtggaagacacattgttggaaggactgattgctggtgaaaccgaaga---cggtggctgaacagccggagacttcgccggtgg |
23867908 |
T |
 |
| Q |
109 |
ggctgttgccggcggtgggggagacgcagacccagatggagaaaccgccggagtttgtgaaggcggagataaagttggagactttgcaggggatgccgga |
208 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23867907 |
ggatgttgccggcggtggggtagacgcagacccagatggagaaaccgccggagtttgtgaaggcggagataaagttggagactttgcaggggatgccgga |
23867808 |
T |
 |
| Q |
209 |
gaatttgtcggagaaactgaaaccgaagacggtggtttcgc |
249 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23867807 |
gaatttgtcggagaaactgaaacggaagacggtggtttcgc |
23867767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University