View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_54 (Length: 246)
Name: NF3906_low_54
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 3246168 - 3246391
Alignment:
| Q |
2 |
tcccttgcttccactgcttttgcaactaattttgtccaagacaacgctggtttgtactttgctttttctaacattaaaattgttggttgatataagatat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3246168 |
tcccttgcttccactgcttttgcaactaattttgtccaagacaacgctggtttgtactttgctttttctaacattaaaattgttggttgatataggatat |
3246267 |
T |
 |
| Q |
102 |
attaaaattttgagtttattatgctaatttaacaacaccaaagaaggtaatttatgggtgaggatcaatgtaataccgacacttttgatcaaaatatcca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| || || |
|
|
| T |
3246268 |
attaaaattttgagtttattatgctaatttaacaacaccgaagaaggtaatttatgggtgaggatcaatgtaatactgacacttttgatcaaaagatgca |
3246367 |
T |
 |
| Q |
202 |
tggtggccaacacgcgtggcactg |
225 |
Q |
| |
|
|||||||||| ||||||| ||||| |
|
|
| T |
3246368 |
tggtggccaatacgcgtgacactg |
3246391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University