View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_56 (Length: 243)
Name: NF3906_low_56
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 5145773 - 5145651
Alignment:
| Q |
1 |
aatatctaaactaactcgagggtaacttcaataacacgtgagagtagaaatatagatttattcattttggtataaacaagcctccaatgattaagaaatt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5145773 |
aatatttaaactaactcgagggtaacttcaataacacgtgagagtagaaatatagatttattcattttggtataaacaagcctccaatgattaagaaatt |
5145674 |
T |
 |
| Q |
101 |
caagtttatgggaacaaaattag |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5145673 |
caagtttatgggaacaaaattag |
5145651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 5145617 - 5145547
Alignment:
| Q |
157 |
gagggaagggaattatccaattcaaggctacatctttataaattcgtgtcaaaggaaatagaaataaaagt |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5145617 |
gagggaagggaattatccaattcatggctacatctttataaattcgtgtcaaaggaaatagaaataaaagt |
5145547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University