View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_59 (Length: 238)
Name: NF3906_low_59
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 45672853 - 45672646
Alignment:
| Q |
14 |
aggtatcaaccctcaacttctcaaaactttcccaatcttactttattctcccatcatcaaacattttaatgaaagtgttgaagatcctctacaatgtgct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45672853 |
aggtatcaaccctcaacttctcaaaactttcccaatcttactttactctaccatcatcaaacattttaatgaaagtattgaagatcctctacaatgtgct |
45672754 |
T |
 |
| Q |
114 |
gtttgtctcggtgatttcaacagcaatgacaaagttcgtgtgctacctcaatgtaatcatgtttttcatcctccatgtattgatgcttggctttcttcgc |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45672753 |
gtttgtctcggtgatttcaacaacaatgacaaagttcgtgtgctacctcaatgtaatcatgtttttcatcctccatgtattgatgcttggctttcttcac |
45672654 |
T |
 |
| Q |
214 |
atgttact |
221 |
Q |
| |
|
|| ||||| |
|
|
| T |
45672653 |
atattact |
45672646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University