View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_63 (Length: 221)
Name: NF3906_low_63
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 17320075 - 17319892
Alignment:
| Q |
15 |
atgaaattagcccttgattttgacactaattagtgttttatannnnnnnctctaactttctagtcaattcaacttatatcatatttatacataaaggtct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17320075 |
atgaaattagcccttgattttgacactaattagtgttttat---tttctctctaactttttagtcaattcaacttatatcatattcatacataaaggtct |
17319979 |
T |
 |
| Q |
115 |
agactctagattaatggaattttcttttattgatgtgtcatattgttaaaagtttatcttcttattgcagactggagagcaggtgaa |
201 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17319978 |
agactctatattaaaggacttttcttttattgatgtgtcatattgttaaaagtttatcttcttattgcagactggagagcaggtgaa |
17319892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 117
Target Start/End: Complemental strand, 17308482 - 17308430
Alignment:
| Q |
65 |
tctaactttctagtcaattcaacttatatcatatttatacataaaggtctaga |
117 |
Q |
| |
|
|||||||||| || ||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
17308482 |
tctaactttcatgttaatacaatttatatcacatttatacataaaggtctaga |
17308430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University