View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3906_low_64 (Length: 220)

Name: NF3906_low_64
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3906_low_64
NF3906_low_64
[»] chr4 (1 HSPs)
chr4 (1-125)||(3245948-3246072)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 3246072 - 3245948
Alignment:
1 ctggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatctgaacctctttcttgaatccttcttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3246072 ctggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatctgaacctctttcttgaatccttcttct 3245973  T
101 tctctcttctgtattgttgttgttg 125  Q
    |||||||||||||||||||||||||    
3245972 tctctcttctgtattgttgttgttg 3245948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University