View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3906_low_66 (Length: 213)
Name: NF3906_low_66
Description: NF3906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3906_low_66 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 46866572 - 46866774
Alignment:
| Q |
14 |
cagagaccacagtccccctaaacatttttaannnnnnnnn---atactagtatatattaattattannnnnnnaataaattatacttccatctcgatcta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||| | |
|
|
| T |
46866572 |
cagagaccacagtccccctaaacatttttaattttttttttttatactagtatatattaattaatttttttttaataaattatacttccatctcgatcca |
46866671 |
T |
|
| Q |
111 |
tctaaacttagttcttggttccgtccctttatacgagaaaggtgcaaaattttgcactggggtggggctgtctcatgacatgaatgacaatgccatgttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46866672 |
tctaaacttagttcttggttccgtccctttatacgagaaaggtgcaaaattttgcactggggtggggctgtctcatgacatgaatgacaatgccatgttg |
46866771 |
T |
|
| Q |
211 |
atc |
213 |
Q |
| |
|
||| |
|
|
| T |
46866772 |
atc |
46866774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University