View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3907_high_5 (Length: 240)
Name: NF3907_high_5
Description: NF3907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3907_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 24361171 - 24360951
Alignment:
| Q |
9 |
accatataatagtacaacacgggatcccctgcggtcaatgttatacactgaccgcagaggtcaccattttcaacttattgttgatcacctaaagcagaca |
108 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361171 |
accatataatagtacaacatgggatcccctgcggtcactgttatacactgaccgcagaggtcactattttcaacttattgttgatcacctaaagcagaca |
24361072 |
T |
 |
| Q |
109 |
accctttccatttggcctgaccttcatataccctgggatgtaggaacggataaaacttaaaaaccaatacatctgtacaattagtagtgaaccctttata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361071 |
accctttccatttggcctgaccttcatataccctaggatgtaggaacggataaaacttaaaaaccaatacatctgtacaattagtagtgaaccctttata |
24360972 |
T |
 |
| Q |
209 |
tctttgtggttatagacttat |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24360971 |
tctttgtggttatagacttat |
24360951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University