View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3907_low_8 (Length: 209)
Name: NF3907_low_8
Description: NF3907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3907_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 193
Target Start/End: Original strand, 7168715 - 7168885
Alignment:
| Q |
23 |
agccgaggataagaagctgattccagatcaactgttactagtacctgtaacttgtggttgtactaaaaatcactctttcgcgaatatcacctactcaatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7168715 |
agccgaggataagaagctgattccagatcaactgttactagtacctgtaacttgtggttgcactaaaaatcactctttcgcgaatatcacctactcaatc |
7168814 |
T |
 |
| Q |
123 |
aagcaaggtgacaacttcttcatactttcaatcacttcataccagaatctcaccaattatcttgaatttaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7168815 |
aagcaaggtgacaacttcttcatactttcaatcacttcataccagaatctcaccaattatcttgaatttaa |
7168885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University